aggregation comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Last reviewed on 2026-08-01. Where a claim depends on a specific study, the study is described rather than over-claimed.
Semaglutide is a synthetic peptide analogue of glucagon-like peptide-1, a gut hormone released after nutrient intake. The molecule contains 31 amino acid residues and differs from the native sequence at several positions. A non-natural residue at position eight resists the enzyme that normally truncates the hormone, while a lysine-linked fatty diacid side chain promotes binding to serum albumin. These two modifications extend the circulating half-life from minutes to roughly one week. The peptide is produced by solid-phase synthesis followed by selective acylation, and its identity and purity are confirmed by spectrometric and chromatographic techniques.
The primary target is the GLP-1 receptor, a class B G protein-coupled receptor expressed on pancreatic beta cells, in the gut, and in several brain regions. Receptor activation raises intracellular cyclic AMP, which potentiates glucose-dependent insulin secretion and lowers glucagon release when blood glucose is elevated. Signalling in the hypothalamus and brainstem is associated with reduced appetite and slower gastric emptying. Because the insulinotropic effect depends on prevailing glucose levels, the hypoglycaemic risk of the peptide alone is described as low in most study settings. The relative contribution of peripheral and central actions remains an active research question.
Large randomised trials in adults with type 2 diabetes and in adults with obesity have reported reductions in body weight and improvements in several cardiovascular risk markers. One outcome trial found a lower incidence of major adverse cardiovascular events in participants with diabetes and established cardiovascular disease. Gastrointestinal effects such as nausea and vomiting are the most frequently reported adverse events and often diminish over time. Changes in lean body mass during weight loss are an area of ongoing investigation. Effects in adolescents and in pregnancy are less well characterised, and current labelling advises against use during pregnancy.
Stability studies focus on deamidation of asparagine and glutamine residues, oxidation of methionine, and aggregation into higher-order species. The fatty acid side chain adds susceptibility to oxidative change and can promote self-association at high concentration. Lyophilised material is comparatively robust when kept cold and dry, while aqueous solutions require refrigeration and protection from light. Forced degradation experiments under heat, acid, base, and peroxide conditions establish the specificity of each analytical method. Which degradation route dominates under real storage conditions depends on the formulation and stays formulation-specific.
Handling guidance for research quantities calls for single-use aliquots, an inert atmosphere where practical, and avoidance of repeated freeze-thaw cycles that accelerate aggregation. Certificates of analysis typically report purity by peak area, water content, counter-ion identity, and residual solvent levels. In the scientific literature the compound is usually described by its full amino acid sequence, its registry number, or its structural class rather than by any proprietary label. Reporting standards vary between journals, and reviewers increasingly request raw chromatograms alongside tabulated purity figures. Whether current purity thresholds are adequate for every experimental context is debated.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Acylated GLP-1 receptor agonist | 31-residue synthetic peptide |
| Molecular formula | C187H291N45O59 | established for the free peptide |
| Appearance | White to off-white powder | as supplied before formulation |
| Solubility | Freely soluble in water | aqueous buffers near neutral pH |
| Typical storage | 2 to 8 degrees Celsius, protected from light | powder and solution forms differ in shelf life |
Semaglutide is a synthetic peptide of thirty-one amino acids that shares roughly ninety-four percent sequence identity with human glucagon-like peptide-1. Two substitutions resist enzymatic cleavage by dipeptidyl peptidase-4, and a fatty diacid side chain attached through a linker promotes binding to serum albumin. That albumin binding slows renal clearance and extends the circulating half-life from minutes to approximately one week. The structural changes are well established in the published literature. Whether the same modifications affect receptor signalling bias in ways that matter clinically remains an open question.
Pharmacological activity arises from agonism at the glucagon-like peptide-1 receptor, a G protein-coupled receptor expressed in the pancreas, the gastrointestinal tract, and the brainstem. Receptor activation raises intracellular cyclic adenosine monophosphate and enhances insulin release in a glucose-dependent manner, an effect that diminishes when blood glucose concentration is low. Other effects include slowed gastric emptying and hypothalamic satiety signalling. These pathways are described well. Receptor desensitisation rates across tissues, relative to the endogenous hormone, are still under investigation, and reported findings differ between laboratories.
The company that developed the compound filed it as a long-acting analogue, and it gained first approval in 2017 for type 2 diabetes. Later authorisations from several regulators extended the indication to chronic weight management, and the World Health Organization added the glucagon-like peptide-1 receptor agonist drug class to its model list of essential medicines in 2023. Production uses solid-phase peptide synthesis followed by side-chain conjugation and chromatographic purification. Supply constraints and cost differences across regions are well documented. Literature on long-term outcomes continues to grow, with many trials reporting surrogate endpoints rather than hard clinical endpoints.
Storage guidance for the finished injectable product distinguishes the unused state from the in-use state. Before first use, pens are kept refrigerated between 2 and 8 degrees Celsius, protected from light, and never frozen, since freezing can disrupt the peptide or the device. After first use, label instructions in several markets permit storage at room temperature up to about 30 degrees Celsius for a limited number of days. Solid research-grade material is normally held at or below minus 20 degrees Celsius, often with desiccant, and allowed to equilibrate before opening.
Quantification and purity assessment rely on separation methods coupled to optical or mass detection. Reversed-phase high-performance liquid chromatography resolves the intact peptide from related impurities and is the standard assay technique. Size-exclusion chromatography measures aggregates, while ion-exchange chromatography separates charge variants produced by deamidation. Mass spectrometry confirms identity and detects mass shifts of a few daltons. In biological matrices, liquid chromatography with tandem mass spectrometry is often used because immunoassays can cross-react with endogenous GLP-1 or with circulating fragments.
As a peptide, semaglutide is sensitive to conditions that break amide bonds or modify side chains. Deamidation of asparagine and glutamine residues, oxidation of methionine and tryptophan, and non-covalent aggregation are the main degradation routes described in published stability work. Rate depends strongly on pH, buffer species, ionic strength, temperature and exposure to light. Formulators therefore choose a defined solution pH and often add excipients such as phosphate buffer, propylene glycol and phenol, each of which plays a separate role in pH control, tonicity or preservation.
Receptor activation follows the canonical Gs pathway: binding increases intracellular cyclic AMP, which promotes protein kinase A activity. In pancreatic beta cells this amplifies glucose-dependent insulin release, so secretion rises when blood glucose is high and changes little when it is low. The same signalling suppresses glucagon release from alpha cells and slows gastric emptying. Receptors in the hypothalamus and brainstem are thought to contribute to reduced appetite and lower energy intake. Which of these effects dominates clinical outcomes remains an area of active study.
Semaglutide is a synthetic peptide analogue of glucagon-like peptide-1, a gut hormone released by intestinal L cells after food intake. The natural hormone acts on pancreatic and central receptors but is degraded within minutes by dipeptidyl peptidase-4 and other peptidases. Semaglutide belongs to the class of long-acting GLP-1 receptor agonists, a group distinguished by structural changes that slow breakdown and extend circulation time. Its development followed earlier short-acting analogues and reflects a general strategy in peptide drug design: preserve receptor activity while blocking proteolytic clearance.
Three structural changes define the molecule. At position 8 an alpha-aminoisobutyric acid residue replaces alanine, which blocks dipeptidyl peptidase-4 cleavage. At position 34 arginine replaces lysine, and at position 26 a lysine carries a C18 fatty diacid attached through a short linker. The fatty chain binds serum albumin, and this albumin association reduces renal filtration and enzymatic attack. The unchanged backbone retains the receptor contacts that produce signalling. The free base has the formula C187H291N45O59 and a molecular weight near 4114 daltons.
=== Amino acid deficiencies === In bacteria and yeast, codon reassignment can be caused by a shortage of required amino acids. Instead of halting protein production all together, tRNA molecules select another amino acid to add to the amino acid chain. This amino acid may have similar properties to the intended amino acid, or it may not. This may cause deformities in the proteins, making them less efficient or even nonfunctional. A hypothesis as to why this phenomenon persists despite the loss of efficiency is that it is preferable for the organism to have a worse version of the protein than to have no protein at all. In some human cancer cells, such as melanoma cells, a similar tactic is used. As an immune response, to try and destroy the cancer, T cells release an enzyme that destroys the essential amino acid tryptophan within the cancer cells. This typically deprives the cancer of many key proteins, killing the cancer cells. However, some cancer cells are able to use codon reassignment to replace the tryptophan with a similar amino acid called phenylalanine. This amino acid replacement and resulting functional protein allows the cancer cell to survive and continue dividing.
The final withdrawal of the Mustang from USAF placed hundreds of P-51s onto the civilian market. The rights to the Mustang design were purchased from North American by the Cavalier Aircraft Corporation, which attempted to market the surplus Mustang aircraft in the US and overseas. In 1967 and again in 1972, the USAF procured batches of remanufactured Mustangs from Cavalier, most of them destined for air forces in South America and Asia that were participating in the Military Assistance Program (MAP). These aircraft were remanufactured from existing original F-51D airframes fitted with new V-1650-7 engines, a new radio, tall F-51H-type vertical tails, and a stronger wing that could carry six 12.7 mm (0.50 in) machine guns and a total of eight underwing hardpoints. Two 1,000-pound (450 kg) bombs and six 127 mm (5 in) rockets could be carried. They all had an original F-51D-type canopy but carried a second seat for an observer behind the pilot. One additional Mustang was a two-seat, dual-control TF-51D (67-14866) with an enlarged canopy and only four wing guns. Although these remanufactured Mustangs were intended for sale to South American and Asian nations through the MAP, they were delivered to the USAF with full USAF markings. They were, however, allocated new serial numbers (67-14862/14866, 67-22579/22582 and 72-1526/1541). The last US military use of the F-51 was in 1968 when the US Army employed a vintage F-51D (44-72990) as a chase aircraft for the Lockheed YAH-56 Cheyenne armed helicopter project.
== Growth of the bacterial culture == Plasmids are almost always purified from liquid bacteria cultures, usually E. coli, which have been transformed and isolated. Virtually all plasmid vectors in common use encode one or more antibiotic resistance genes as a selectable marker, for example a gene encoding ampicillin or kanamycin resistance, which allows bacteria that have been successfully transformed to multiply uninhibited. Bacteria that have not taken up the plasmid vector are assumed to lack the resistance gene, and thus only colonies representing successful transformations are expected to grow. Bacteria are grown under favourable conditions.
This article incorporates text from a publication now in the public domain: Chisholm, Hugh, ed. (1911). "Glucoside". Encyclopædia Britannica. Vol. 12 (11th ed.). Cambridge University Press. pp. 142–143.
Sources: en.wikipedia.org
2 CH4 + 3 O2 → 4 H2O + 2 CO CH4 + O2 → 2 H2O + C See the alkane heat of formation table for detailed data. The standard enthalpy change of combustion, ΔcH⊖, for alkanes increases by about 650 kJ/mol per CH2 group. Branched-chain alkanes have lower values of ΔcH⊖ than straight-chain alkanes of the same number of carbon atoms, and so can be seen to be somewhat more stable.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
2 March – Bertie O'Brien, 71, Gaelic footballer and hurler (St. Finbarr's, Cork senior teams). 3 March Camille Souter, 93, artist. Rita O'Hare, 80, Republican activist. 5 March – Maurice Scully, 70, poet. 10 March – Niall Brophy, 87, rugby union player (Leinster, national team, Lions). 12 March – Liam Kearns, 61, Gaelic footballer (Austin Stacks, Kerry senior team) and manager (Limerick, Laois, Tipperary, Offaly). 13 March – Tom Ryan, 81, hurler (Killenaule, Éire Óg, James Stephens, Tipperary senior team). 22 March – Marcus Wilson, 91, Gaelic footballer (St. Vincent's, Dublin senior teams). 25 March – Ger Glavin, 66, hurler (Midleton) and Gaelic footballer (Ballincollig, Imokilly, Cork senior team). 28 March – Jimmy Gray, 93, Gaelic footballer and hurler (Na Fianna, Dublin senior teams). 31 March – Harry Cassidy, 92, Gaelic footballer and manager (Bellaghy, Derry senior team). Born in Northern Ireland.
Sources: en.wikipedia.org
In the study of anatomy, viscera (sing.: viscus) refers to the internal organs of the abdominal, thoracic, and pelvic cavities. The abdominal organs may be classified as solid organs or hollow organs. The solid organs are the liver, pancreas, spleen, kidneys, and adrenal glands. The hollow organs of the abdomen are the stomach, intestines, gallbladder, bladder, and rectum. In the thoracic cavity, the heart is a hollow, muscular organ. Splanchnology is the study of the viscera. The term "visceral" is contrasted with the term "parietal", meaning "of or relating to the wall of a body part, organ or cavity". The two terms are often used in describing a membrane or piece of connective tissue, referring to the opposing sides.
Treatments used in children are primarily lifestyle interventions and behavioral techniques, although efforts to increase activity in children have had little success. In the United States, medications are not FDA approved for use in this age group. Brief weight management interventions in primary care (e.g. delivered by a physician or nurse practitioner) have only a marginal positive effect in reducing childhood overweight or obesity. Multi-component behaviour change interventions that include changes to dietary and physical activity may reduce BMI in the short term in children aged 6 to 11 years, although the benefits are small and quality of evidence is low.
=== Prescribing restrictions === Isotretinoin is a teratogen; there is about a 20–35% risk for congenital defects in infants exposed to the drug in utero, and about 30–60% of children exposed to isotretinoin prenatally have been reported to show neurocognitive impairment. Because of this risk, there are strict controls prescribing isotretinoin to women who have potential to become (or be) pregnant while taking isotretinoin and many are strongly advised to terminate their pregnancies because of the 20-60% risk. Isotretinoin is also not recommended for use by breastfeeding women. In the United States, since March 2006, the dispensing of isotretinoin is run through the iPLEDGE program, under the direction of the Food and Drug Administration. Prescribers, pharmacists, and all people to whom the drug is prescribed need to register on the site and log information into it. Women with child-bearing potential must commit to using two forms of effective contraception simultaneously for the duration of isotretinoin therapy and for a month immediately preceding and a month immediately following therapy. Additionally, they must have two negative pregnancy tests 30 days apart and have negative pregnancy tests before each prescription is written. In most countries, isotretinoin can only be prescribed by dermatologists or specialist physicians; some countries also allow limited prescriptions by general practitioners and family doctors. In the United Kingdom and Australia, isotretinoin may be prescribed only by or under the supervision of a consultant dermatologist.
Briskets can be cooked in many ways, including baking, boiling and roasting. It is often basted during cooking. This cut of meat starts out tough because of the collagen fibers that make up the significant connective tissue. Long cooking tenderizes it as the collagen gelatinises. The fat cap, which is often left attached, helps to keep the meat from drying during prolonged cooking. Popular cooking methods in the United States include rubbing with a spice rub or marinating the meat, and then cooking slowly over indirect heat from charcoal or wood. This is a form of smoking the meat. A hardwood, such as oak, pecan, hickory or mesquite is sometimes added, alone or in combination with other hardwoods, to the main heat source. Sometimes, they make up all of the heat sources, with chefs often prizing characteristics of certain woods. The smoke from the woods and from burnt dripping juices further enhances the flavor. The finished meat is a variety of barbecue. Smoked brisket done this way is popular in Texas barbecue. Once finished, pieces of brisket can be returned to the smoker to make burnt ends. Burnt ends are most popular in Kansas City-style barbecue, where they are traditionally served open-faced on white bread. The traditional New England boiled dinner features brisket as a main-course option. In the United States, the whole boneless brisket is defined as IMPS 120.
Sources: en.wikipedia.org
Native GLP-1 is degraded within minutes by dipeptidyl peptidase-4 and neutral endopeptidases. Semaglutide carries a non-natural amino acid at position eight that blocks that cleavage, and a fatty diacid side chain that binds albumin. The result is a much longer duration of action than the native hormone.
The fatty diacid chain associates strongly with serum albumin, which keeps the peptide in circulation and shields it from rapid renal clearance. Bound peptide is released gradually, producing a sustained receptor signal. This mechanism also reduces the peak-to-trough variation seen with shorter-acting analogues.
The balance between peripheral receptor activation and signalling in the central nervous system is not fully resolved. The extent to which slowed gastric emptying accounts for reduced energy intake, compared with direct effects on appetite circuits, is debated. Long-term effects on lean mass and on tissues outside the gut and brain are still under study.
Purity is commonly expressed as the percentage of the main peak relative to all integrated peaks in a reversed-phase chromatogram. Related substances and counter-ions are reported separately. Values obtained with different detectors are not always directly comparable.